View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_27 (Length: 456)
Name: NF18993_low_27
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 4e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 67 - 255
Target Start/End: Complemental strand, 34095170 - 34094983
Alignment:
| Q |
67 |
aagtgaaaagagagaaagagaaaagtgttatgtggtgaaagtgttttgtgtgtttatatagnnnnnnngtgtgagggttttattttatgaaggaaaagga |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34095170 |
aagtgaaaagagagaaagagaaaagtgttatgtggtgaaagtgttttgtgtgtttatatagaaaaaa-gtgtgagggttttattttatgaaggaaaagga |
34095072 |
T |
|
| Q |
167 |
aaatcagaatgtgttggtgaaaattggtgaaaggacattttggtatatgtgtgtaatgcttttggggggtcttattgttttgggaaccc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
34095071 |
aaatcagaatgtgttggtgaaaattggtgaaaggacattttggtatatgtgtgtaatgcttttggagggtcttattgttttggggaccc |
34094983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 351 - 450
Target Start/End: Complemental strand, 34094887 - 34094791
Alignment:
| Q |
351 |
ataattttatttatcacatgtggacacactctctcttgttgctaatccttaattttaagatttgcattttggtttattttgtaggactatattttcttcg |
450 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34094887 |
ataattttatttatcacatgtggacacactctctcttgttt---atccttaattttaagatttgcattttggtttattttgtaggactatattttattcg |
34094791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University