View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_34 (Length: 431)
Name: NF18993_low_34
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 38 - 424
Target Start/End: Complemental strand, 27114524 - 27114135
Alignment:
| Q |
38 |
aaatagtatggcagttgtttaacttcaagtaacatcaccctccatatggtgatttcatcgtctgtttttgaaatttaacggggtttgcttttcaaattcc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
27114524 |
aaatagtatggcagttgtttaacttcaagtaacatcaccctccatatggtgatttcatcgtctgtttttgaaatttaatgtggtttgcttttcaaattcc |
27114425 |
T |
 |
| Q |
138 |
aaaatatt--gtgtaatttgcaaggacatttgtgcattatgttttctttttatgctatgttat-gttattgtctttaagtagcattgtaatctgtaaatt |
234 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27114424 |
aaaatattatgtgtaatttgcaaggacatttgtgcattatgttttctttttatgctatgtttttgttactgtctttaagtagcattgtaatctgtaaatt |
27114325 |
T |
 |
| Q |
235 |
catctgacttcatatcgcgtttgttgcctttagagcaatgatcaatcgctgcttcttctatctttaatttggaatcaatgtgttatttacatccataacg |
334 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27114324 |
catctgacttgatatcgcgtttgttgcctttagagcaatgatcaatcgctgcttcttctatctttaatttggaatcaacgtgttgtttacatccataacg |
27114225 |
T |
 |
| Q |
335 |
ttgtgaactgttgattcatcattaggggtaagaaatgaatgaaattcagtatcctcataggttaatgccattaacttaatggagaataat |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27114224 |
ttgtgaactgttgattcatcattaggggtaagaaatgaatgaaattcagtatcctcataggttaatgccattaacttaatggagaataat |
27114135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University