View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_51 (Length: 372)
Name: NF18993_low_51
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 307 - 359
Target Start/End: Complemental strand, 24731368 - 24731316
Alignment:
| Q |
307 |
atgaacagtgaaagtatgaatgagacaggtcctttctgctgacagactacttc |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24731368 |
atgaacagtgaaagtatgaatgagacaggtcctttctgctgacagactgcttc |
24731316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 130 - 271
Target Start/End: Original strand, 12914922 - 12915063
Alignment:
| Q |
130 |
atgaggtttgagtcactgggtattgcttgcgaacatgttttatatgttttgatttatcttaatatacttgtcatgcctccttgtattgttctggaaagat |
229 |
Q |
| |
|
|||||| |||||||| |||| ||| |||| || ||| || ||| |||||| ||| ||||||| || |||||||||| || |||| ||||| |||| |
|
|
| T |
12914922 |
atgaggcttgagtcattgggaattccttgtgagcatattgtatctgttttaattcatcttaacatcattgtcatgcccagttctattattctgccgagat |
12915021 |
T |
|
| Q |
230 |
ggaccaaaagtgtcaaagttgctgttaacgctgcaaatgcaa |
271 |
Q |
| |
|
|||| ||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
12915022 |
ggacgaaaggtgtgaaagatgctgttaacgctgcaaatgcaa |
12915063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 130 - 271
Target Start/End: Complemental strand, 12921172 - 12921031
Alignment:
| Q |
130 |
atgaggtttgagtcactgggtattgcttgcgaacatgttttatatgttttgatttatcttaatatacttgtcatgcctccttgtattgttctggaaagat |
229 |
Q |
| |
|
|||||| |||||||| |||| ||| |||| || ||| || ||| |||||| ||| ||||||| || |||||||||| || |||| ||||| |||| |
|
|
| T |
12921172 |
atgaggcttgagtcattgggcattccttgtgagcatattgtatctgttttaattcatcttaacatcattgtcatgcccatttctattattctgccgagat |
12921073 |
T |
|
| Q |
230 |
ggaccaaaagtgtcaaagttgctgttaacgctgcaaatgcaa |
271 |
Q |
| |
|
|||| ||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
12921072 |
ggacgaaaggtgtgaaagatgctgttaacgctgcaaatgcaa |
12921031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University