View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_63 (Length: 339)
Name: NF18993_low_63
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 220 - 325
Target Start/End: Complemental strand, 31810048 - 31809943
Alignment:
| Q |
220 |
catgctcctatggtacggtattgcagaaagaccttgaacctttgggtctgcttcgtttctctgaaacagtacattatgggtctatgcacgtgggctggta |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31810048 |
catgctcctatggtacggtattgcagaaagaccttgaacctttgggtctgcttcgtttctctgaaacagtacattatgggtctatgcacgtgggctggta |
31809949 |
T |
 |
| Q |
320 |
caattt |
325 |
Q |
| |
|
|||||| |
|
|
| T |
31809948 |
caattt |
31809943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 51 - 115
Target Start/End: Complemental strand, 31810215 - 31810151
Alignment:
| Q |
51 |
tgtatttgtgtgccccaaaactttaatttggatttgtttctaagtatttctctatattttgaagg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31810215 |
tgtatttgtgtgccccaaaactttaatttggatttgtttctaagtatttctctatattttgaagg |
31810151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University