View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_74 (Length: 311)
Name: NF18993_low_74
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_74 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 10 - 311
Target Start/End: Complemental strand, 41850118 - 41849817
Alignment:
| Q |
10 |
gcagagagaagaatggccaacctttcaattcaactcccacgaaccagtttggccatacgcaactactcaaccaaacgaccatgtttcaccacttctgctt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41850118 |
gcagaaagaagaatggccaacctttcaattcaactcccacgaacaagtttgtccatacgcaacttctcaaccaaacgaccatgtttcaccacttctgctt |
41850019 |
T |
 |
| Q |
110 |
tacccttcacaatcacttgctctggtctcgctctctttcatttctttctcttcattttataccattgcttacttcatgtaaaataaccaagacattcaaa |
209 |
Q |
| |
|
||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41850018 |
taccctttacaatcacttgctctggtcttactctatttcatttctttctcttcattttataccattgcttacttcatgtaaaataaccaagacattcaaa |
41849919 |
T |
 |
| Q |
210 |
tttgtttgttctgttgtagttgtaggagaagctgagttagatggaactgagaataagccaaggttacttagtctcaacaaaatcaagggtgttgcctgtg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41849918 |
tttgtttgttctgttgtagttgtaggagaagctgagttagatggaactgagaataagccaaggttacttagtctcaacaaaatcaagggtgttgcctgtg |
41849819 |
T |
 |
| Q |
310 |
gt |
311 |
Q |
| |
|
|| |
|
|
| T |
41849818 |
gt |
41849817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University