View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_89 (Length: 281)
Name: NF18993_low_89
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_89 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 273
Target Start/End: Complemental strand, 11025514 - 11025259
Alignment:
| Q |
18 |
acaaatcaataaaacgttagctatcattacatctctgatacctaaatatgcaaacaacgcagacgtaagtggatcacttgattgttgcaagcaacaatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11025514 |
acaaatcaataaaacgttagctatcattacatctctgatacctaaatatgcaaacaacgcagacgtaagtggatcacttgattgttgcaagcaacaatat |
11025415 |
T |
|
| Q |
118 |
gaaatgatgcccgattctataaccaatgccgttgcggccctcgctgtgcgcaatgctcaagaagtaaatgcccaatttagcgcgattctttcataccata |
217 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
11025414 |
gaaatgatgcctgattctataaccaatgccgttgcggccctcgctgtgcgcaatgctcaagaagtaaatgctcaatttagcgggattctttcataccata |
11025315 |
T |
|
| Q |
218 |
cctcttgtgtagatacttttgctgagagtactgattatcctgttgcaccctttgct |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11025314 |
cctcttgtgtagatacttttgctgagagtaatgattatcctgttgcaccctttgct |
11025259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University