View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_94 (Length: 273)
Name: NF18993_low_94
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_94 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 40 - 257
Target Start/End: Complemental strand, 33946657 - 33946426
Alignment:
| Q |
40 |
tatgagctaaaaccacaatactaaagcaattatttgtcattacgtataaa--------aacatt---cattcattcataacttttcagaacccgaataat |
128 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||| |
|
|
| T |
33946657 |
tatgagctaaa-ccacaatactaaagcaattatttgtcattacgtataatttataaccaagataaaacattcattcataacttttcagaacccgaataat |
33946559 |
T |
 |
| Q |
129 |
gaaagaacaaataattagcactttcattcatattacaacgacccacac----nnnnnnnnnnnntatagaaactaaattttgcatcctttttgaagtaga |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
33946558 |
gaaagaacaaataattagcactttcattcatattacaacgacccacacaaaaaaaaaaaaaaaaaattgaaactaaattttgcatcctttttgaagtaga |
33946459 |
T |
 |
| Q |
225 |
ctatatttgattggaatacggttatgaagtaat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33946458 |
ctatatttgattggaatacggttatgaagtaat |
33946426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University