View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18993_low_94 (Length: 273)

Name: NF18993_low_94
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18993_low_94
NF18993_low_94
[»] chr8 (1 HSPs)
chr8 (40-257)||(33946426-33946657)


Alignment Details
Target: chr8 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 40 - 257
Target Start/End: Complemental strand, 33946657 - 33946426
Alignment:
40 tatgagctaaaaccacaatactaaagcaattatttgtcattacgtataaa--------aacatt---cattcattcataacttttcagaacccgaataat 128  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||         || ||    |||||||||||||||||||||||||||||||||    
33946657 tatgagctaaa-ccacaatactaaagcaattatttgtcattacgtataatttataaccaagataaaacattcattcataacttttcagaacccgaataat 33946559  T
129 gaaagaacaaataattagcactttcattcatattacaacgacccacac----nnnnnnnnnnnntatagaaactaaattttgcatcctttttgaagtaga 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||                 || ||||||||||||||||||||||||||||||||    
33946558 gaaagaacaaataattagcactttcattcatattacaacgacccacacaaaaaaaaaaaaaaaaaattgaaactaaattttgcatcctttttgaagtaga 33946459  T
225 ctatatttgattggaatacggttatgaagtaat 257  Q
    |||||||||||||||||||||||||||||||||    
33946458 ctatatttgattggaatacggttatgaagtaat 33946426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University