View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18993_low_99 (Length: 266)
Name: NF18993_low_99
Description: NF18993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18993_low_99 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 8e-70; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 12 - 149
Target Start/End: Complemental strand, 27549527 - 27549390
Alignment:
| Q |
12 |
tatacttattacaagacaaacattgcacgatcggtggcggcaaatttcagttctgttttagttgatgacgaccaaattgctgccaatcttctcaaatatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27549527 |
tatacttattacaagacaaacattgcacgatcggtggcggcaaatttcagttctgttttagttgatgacgaccaaattgctgccaatcttctcaaatatg |
27549428 |
T |
|
| Q |
112 |
gacctcttgctggtgagtaataccctaaaaatctgaac |
149 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27549427 |
gacctcttgctggtgagtaataccctaacaatctgaac |
27549390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 12 - 140
Target Start/End: Original strand, 27945191 - 27945319
Alignment:
| Q |
12 |
tatacttattacaagacaaacattgcacgatcggtggcggcaaatttcagttctgttttagttgatgacgaccaaattgctgccaatcttctcaaatatg |
111 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||| ||||||| || |||||||| | ||| ||| |
|
|
| T |
27945191 |
tatacttattataagacaaacactgcacgatcggtggcggcaaatttcagttctatttcggttgatgacaaccaaatcgccgccaatctcgttaaacatg |
27945290 |
T |
|
| Q |
112 |
gacctcttgctggtgagtaataccctaaa |
140 |
Q |
| |
|
|||||||||||||| |||||||| ||||| |
|
|
| T |
27945291 |
gacctcttgctggtcagtaatactctaaa |
27945319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 12 - 140
Target Start/End: Original strand, 27436699 - 27436827
Alignment:
| Q |
12 |
tatacttattacaagacaaacattgcacgatcggtggcggcaaatttcagttctgttttagttgatgacgaccaaattgctgccaatcttctcaaatatg |
111 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||| ||||||| | |||||||| | ||| ||| |
|
|
| T |
27436699 |
tatacttattataagacaaacactgcacgatcggtggcggcaaatttcagttctatttcggttgatgacaaccaaatcaccgccaatctcgttaaacatg |
27436798 |
T |
|
| Q |
112 |
gacctcttgctggtgagtaataccctaaa |
140 |
Q |
| |
|
|||||||||||||| |||||||| ||||| |
|
|
| T |
27436799 |
gacctcttgctggtcagtaatactctaaa |
27436827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 201 - 266
Target Start/End: Complemental strand, 27549338 - 27549273
Alignment:
| Q |
201 |
caaatgttcacaaatgcagttgccataaatgcggcatacatgcagacatacgtggtaggtgtatcg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27549338 |
caaatgttcacaaatgcagttgccataaatgcggcatacatgcagacatacgtgggaggtgtatcg |
27549273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 255
Target Start/End: Original strand, 27436879 - 27436933
Alignment:
| Q |
201 |
caaatgttcacaaatgcagttgccataaatgcggcatacatgcagacatacgtgg |
255 |
Q |
| |
|
||||||||||||||||||| ||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
27436879 |
caaatgttcacaaatgcagctgcaataaacgcggtatacatgcagacatacgtgg |
27436933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 255
Target Start/End: Original strand, 27945371 - 27945425
Alignment:
| Q |
201 |
caaatgttcacaaatgcagttgccataaatgcggcatacatgcagacatacgtgg |
255 |
Q |
| |
|
||||||||||||||||||| ||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
27945371 |
caaatgttcacaaatgcagctgcaataaacgcggtatacatgcagacatacgtgg |
27945425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University