View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18994_low_2 (Length: 421)
Name: NF18994_low_2
Description: NF18994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18994_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 401
Target Start/End: Original strand, 23324152 - 23324542
Alignment:
| Q |
1 |
tttcttgttggaatccagaaatgaacttgtcttggaaatggattggacttaggttgttcattagtttttgcagctgatttttagcttcatctctttcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23324152 |
tttcttgttggaatccagaaatgaacttgtcttggaaatggattggacttgggttgttcattagtttttgcagctgatttttagcttcatctctttctag |
23324251 |
T |
 |
| Q |
101 |
gtacgctgttttaagtagattgaacagttctgtcttcatgtttttcattgcttcaagttcaagtgttgtgtctatgagtttttgtcttagttcatgttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23324252 |
gtacgctgttttaagtagattgaacagttctgtcttcatgtttttcattgcttcaagttcaagtgttgtgtctatgagtttttgtcttagttcatgttcc |
23324351 |
T |
 |
| Q |
201 |
ctctgcaaaatcaaacaaggaaaattttagtttgttttgaaggggaaaaaattatgattattcaaa-tcaaggcaatggttcataaatgaaactaatcat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||| ||| |||||| |||||||||| ||||||| |
|
|
| T |
23324352 |
ctctgcaaaatcaaacaaggaaaattttagttggttttgaagggaaaaaagttatgattatttaaagtcaagg---------ataaatgaaagtaatcat |
23324442 |
T |
 |
| Q |
300 |
gtttgttccgcgatggaaatcgagggatttgtgttgtatgcaatcagaatctaatgcgttttttcagtcaaaatatcgatggccatggaatcaggaaata |
399 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
23324443 |
gtttgtt--aagatggaaatcgagggatttgggttgtatgcaattggaatctaatgcgtttattcagtcaaaacatcgatggctgcagaatcaggaaata |
23324540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University