View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18995_high_21 (Length: 272)
Name: NF18995_high_21
Description: NF18995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18995_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 12 - 137
Target Start/End: Original strand, 2930773 - 2930898
Alignment:
| Q |
12 |
atcatcatgaaaagaaaatgattgatttttctaatgcatccggatgcattcgatttactacaataacaggaacgatcagggatcatgggcaatagatagc |
111 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2930773 |
atcattatgaaaggaaaatgattgatttttctaatgcatccggatgcattcgatttactacaataacaggaacgatcggggatcatgggcaatagatagc |
2930872 |
T |
|
| Q |
112 |
atgtattttatctactattgtttctc |
137 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2930873 |
atgtattttatctactattgtttctc |
2930898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 259
Target Start/End: Original strand, 2937206 - 2937259
Alignment:
| Q |
206 |
aatgaagaaaaattctcttgcaatgaaaaaacactagtagttaatggatgttta |
259 |
Q |
| |
|
||||||| ||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
2937206 |
aatgaagtaaaattctcttgcaatgaagaaaaactagtagttaatggatgttta |
2937259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University