View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18995_high_22 (Length: 263)
Name: NF18995_high_22
Description: NF18995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18995_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 19666802 - 19666670
Alignment:
| Q |
1 |
atggaatatggcttttgttattgaacatgtatatcccaacaaagcatcaaatcgtagtactaactacaaaaacttcatcattatattcccatgatgttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||| ||||||||||||||||||||| || |
|
|
| T |
19666802 |
atggaatatggcttttgttattgaacatgtatatcccaacaaagcatgaaatcatagtactaactacaaagacttgatcattatattcccatgatgtaat |
19666703 |
T |
|
| Q |
101 |
gtctaaacagtacatggtacatttattattgtg |
133 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
19666702 |
gtctaaacagtacatgttacatttattattgtg |
19666670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 177 - 235
Target Start/End: Complemental strand, 19666597 - 19666539
Alignment:
| Q |
177 |
ttctattttggattttgcatacaaatgtgaaaagtgccacgagattgctaccattatat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19666597 |
ttctattttggattttgcatacaaatgtgaaaagtgccacgagattgctaccattatat |
19666539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University