View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18995_low_11 (Length: 388)
Name: NF18995_low_11
Description: NF18995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18995_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 14 - 315
Target Start/End: Original strand, 38277881 - 38278178
Alignment:
| Q |
14 |
catatagcatacactccatttgattatatttataaacaattttgtttataaat----atgagtaaagagagtaaaatgttatatgagattgagggagtat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38277881 |
catatagcatacactccatttgattatatttataaacaattttgtttataaattaatatgactaaagagagtaaaatgttatatgagattgagggagtat |
38277980 |
T |
|
| Q |
110 |
gtgaatttagagcataattggaattctatgatgacacaacatatggatctataccttagaaaccattggttgctttctcatccaaaaaccaaaatcaaag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38277981 |
gtgaatttagagcataattggaattctatgatgacacaacacatggatctataccttagaaaccattggttgctttctcatccaaaaaccaaaatcaaag |
38278080 |
T |
|
| Q |
210 |
ataagacgataaggccatgtggcaaaaaaccaatacatcttcctctcatatcaccataacacaaaatctctcctactctctctcaacacaatcatggctt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
38278081 |
ataagacgataaggccatgtggcaaaaaaccaatacatcttcctctcatatcaccataacacaaact--------ctctctctcaacacaatcatggctt |
38278172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University