View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18995_low_22 (Length: 272)

Name: NF18995_low_22
Description: NF18995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18995_low_22
NF18995_low_22
[»] chr1 (2 HSPs)
chr1 (12-137)||(2930773-2930898)
chr1 (206-259)||(2937206-2937259)


Alignment Details
Target: chr1 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 12 - 137
Target Start/End: Original strand, 2930773 - 2930898
Alignment:
12 atcatcatgaaaagaaaatgattgatttttctaatgcatccggatgcattcgatttactacaataacaggaacgatcagggatcatgggcaatagatagc 111  Q
    ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
2930773 atcattatgaaaggaaaatgattgatttttctaatgcatccggatgcattcgatttactacaataacaggaacgatcggggatcatgggcaatagatagc 2930872  T
112 atgtattttatctactattgtttctc 137  Q
    ||||||||||||||||||||||||||    
2930873 atgtattttatctactattgtttctc 2930898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 259
Target Start/End: Original strand, 2937206 - 2937259
Alignment:
206 aatgaagaaaaattctcttgcaatgaaaaaacactagtagttaatggatgttta 259  Q
    ||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||    
2937206 aatgaagtaaaattctcttgcaatgaagaaaaactagtagttaatggatgttta 2937259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University