View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18995_low_23 (Length: 263)

Name: NF18995_low_23
Description: NF18995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18995_low_23
NF18995_low_23
[»] chr3 (2 HSPs)
chr3 (1-133)||(19666670-19666802)
chr3 (177-235)||(19666539-19666597)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 19666802 - 19666670
Alignment:
1 atggaatatggcttttgttattgaacatgtatatcccaacaaagcatcaaatcgtagtactaactacaaaaacttcatcattatattcccatgatgttat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||| ||||||||||||||||||||| ||    
19666802 atggaatatggcttttgttattgaacatgtatatcccaacaaagcatgaaatcatagtactaactacaaagacttgatcattatattcccatgatgtaat 19666703  T
101 gtctaaacagtacatggtacatttattattgtg 133  Q
    |||||||||||||||| ||||||||||||||||    
19666702 gtctaaacagtacatgttacatttattattgtg 19666670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 177 - 235
Target Start/End: Complemental strand, 19666597 - 19666539
Alignment:
177 ttctattttggattttgcatacaaatgtgaaaagtgccacgagattgctaccattatat 235  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19666597 ttctattttggattttgcatacaaatgtgaaaagtgccacgagattgctaccattatat 19666539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University