View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18995_low_32 (Length: 238)
Name: NF18995_low_32
Description: NF18995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18995_low_32 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 11 - 238
Target Start/End: Original strand, 2930572 - 2930799
Alignment:
| Q |
11 |
atcatcaccaactgcctcttaagatgatgccgcgtctcatggagcctgttaaagcattgttcacgcctatagaaaagtgactctgcgtcacacttcactt |
110 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930572 |
atcatcaccaactgcctcttaagttgatgccgcatctcatggagcctgttaaagcattgttcacgcctatagaaaagtgactctgcgtcacacttcactt |
2930671 |
T |
 |
| Q |
111 |
ttaccacttttcgcaaataaccacatttttcaaatacttacttgagcggagtgcctgaagacacatttctcctccattgtgaagattaattcaaccgacc |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2930672 |
ttaccacttttcgcaaataaccacctttttcaaatacttacttgagcggagtgcctggagacacatttctcctccattgtgaagattaattcaactgacc |
2930771 |
T |
 |
| Q |
211 |
gatcattatgaaaagaaaatgattgatt |
238 |
Q |
| |
|
||||||||||||| |||||||||||||| |
|
|
| T |
2930772 |
gatcattatgaaaggaaaatgattgatt |
2930799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University