View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18996_high_18 (Length: 324)
Name: NF18996_high_18
Description: NF18996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18996_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 43429004 - 43429309
Alignment:
| Q |
1 |
ttcattttatttcgtaaccttgtacatgtttgatcaaaacgcctcgttcgttgattgtgttgttgttagagacttgcggcaaaataagacggttcctctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43429004 |
ttcattttatttcgtaaccttgtacatgtttgatcaaaatgcctcgttcattgattgtgttgttgttagagacttgcggcaaaataagacggttcctctg |
43429103 |
T |
 |
| Q |
101 |
tgtagttagttaatttgatctccacatttaaagaagtataggtgttttatatgtaaatttgatcccgtttggccattgatcttcaagtacctaaaatcat |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43429104 |
tgtagttagttaatttgatctccacttttaaagaagtataggtgttttatatgtaaatgtgatccccattggccattgatcttcaagtacctaaaatcat |
43429203 |
T |
 |
| Q |
201 |
actcttataaatgtagtga-nnnnnnngaagaaagtttgctttgcatgaatctagcccttccaatagtgatatgattaatgttagcgtttattagagagt |
299 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43429204 |
actcttataaatgtagtgattttttttgaagaaagtttgctttgcatgaatctagcccttccaatagtgatatgattaattttagcgtttattagagagt |
43429303 |
T |
 |
| Q |
300 |
agggaa |
305 |
Q |
| |
|
|||||| |
|
|
| T |
43429304 |
agggaa |
43429309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University