View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18996_high_20 (Length: 315)
Name: NF18996_high_20
Description: NF18996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18996_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 172 - 297
Target Start/End: Complemental strand, 21426949 - 21426824
Alignment:
| Q |
172 |
ggacaatatataaaacccctttttattttgagaacatctatagatcgaggaaaactcaagtatatgagattcagaatctataggccatgatatgtgtggt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21426949 |
ggacaatatataaaacccctttttattttgagaacatctatagatcgaggaaaactcaagtatatgagattcagaatctataggccatgatatgtatggt |
21426850 |
T |
|
| Q |
272 |
ttaagaatttaaaatatgtccaattt |
297 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
21426849 |
ttaagaatttaaaatatgtccaattt |
21426824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 21427120 - 21427010
Alignment:
| Q |
1 |
agctacaatatacacagagaaa-gaggacaatttcttgtggaatttgtctaaagataaactaaaaagagggaacaaaggaaagaatctacccaggtgaaa |
99 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21427120 |
agctacaatatacacagagaaaagaggacaatttcttgtggaatttgtctaaagataaactaaaaagagggaacaaaggagagaatctacccaggtgaaa |
21427021 |
T |
|
| Q |
100 |
ccctttcctcg |
110 |
Q |
| |
|
||||||||||| |
|
|
| T |
21427020 |
ccctttcctcg |
21427010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University