View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18996_high_21 (Length: 308)

Name: NF18996_high_21
Description: NF18996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18996_high_21
NF18996_high_21
[»] chr5 (2 HSPs)
chr5 (140-286)||(3020447-3020593)
chr5 (34-148)||(3020908-3021022)


Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 140 - 286
Target Start/End: Complemental strand, 3020593 - 3020447
Alignment:
140 tatagtttattggtgggatggcaaaggaacagaaccacgcgaacacggggacaataagataatcttaaatgtgggcccagcggccacggctttcactact 239  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
3020593 tatagtttattggtggaatggcaaaggaacagaaccacgcgaacacggggacaataagataatcttaaatgtgggcccaggggccacggctttcactact 3020494  T
240 gctaagcaagcactacaattgttattttttctgagacagcgatgcat 286  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||    
3020493 gctaagcaagcactacagttgttattttttctgagacagcgatgcat 3020447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 34 - 148
Target Start/End: Complemental strand, 3021022 - 3020908
Alignment:
34 aatccattatttgaataagttgcttatgtgattgaattgaatattattagcttgggaatttttcgtatcaatagttattgaagaaaatgtgttggtgtgg 133  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
3021022 aatccattatttgaataagttgcttatgtgattgaattgaatattattagcttgggaattttttgtatcaatagttattgaagaaaatgtgttggtgtgg 3020923  T
134 agtttatatagttta 148  Q
    |||||||||||||||    
3020922 agtttatatagttta 3020908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University