View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18996_high_21 (Length: 308)
Name: NF18996_high_21
Description: NF18996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18996_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 140 - 286
Target Start/End: Complemental strand, 3020593 - 3020447
Alignment:
| Q |
140 |
tatagtttattggtgggatggcaaaggaacagaaccacgcgaacacggggacaataagataatcttaaatgtgggcccagcggccacggctttcactact |
239 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3020593 |
tatagtttattggtggaatggcaaaggaacagaaccacgcgaacacggggacaataagataatcttaaatgtgggcccaggggccacggctttcactact |
3020494 |
T |
 |
| Q |
240 |
gctaagcaagcactacaattgttattttttctgagacagcgatgcat |
286 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3020493 |
gctaagcaagcactacagttgttattttttctgagacagcgatgcat |
3020447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 34 - 148
Target Start/End: Complemental strand, 3021022 - 3020908
Alignment:
| Q |
34 |
aatccattatttgaataagttgcttatgtgattgaattgaatattattagcttgggaatttttcgtatcaatagttattgaagaaaatgtgttggtgtgg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3021022 |
aatccattatttgaataagttgcttatgtgattgaattgaatattattagcttgggaattttttgtatcaatagttattgaagaaaatgtgttggtgtgg |
3020923 |
T |
 |
| Q |
134 |
agtttatatagttta |
148 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3020922 |
agtttatatagttta |
3020908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University