View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18996_high_23 (Length: 283)
Name: NF18996_high_23
Description: NF18996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18996_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 2223108 - 2222844
Alignment:
| Q |
1 |
ttgctgccccgccgccacaaaacgtggaatccccttaatagcatcttccannnnnnnnnnnngcccaatcaccgataaaaaaccatgtgacgtgggggcg |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |||||||||||||| || |||| |
|
|
| T |
2223108 |
ttgctgctccgccgccacaaaacgtggaatcaccttaatagcatcttccatcaccctcctccgcccaatcaccgatataaaaccatgtgacgcggtggcg |
2223009 |
T |
 |
| Q |
101 |
gtttctccggtggttgattccatcgtaggaaccaccgccactttgcatggacgctttctcttccttctataatcatcgtaacgccgctcaatttctttag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223008 |
gtttctccggtggttgattccatcgtaggaaccactgccactttgcatggacgctttctcttccttctataatcatcgtaacgccgctcaatttctttag |
2222909 |
T |
 |
| Q |
201 |
atttattaatattgtcggcaacaatattattaggatcatccataatatttgacaacttcctctta |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222908 |
atttattaatattgtcggcaacaatattattaggatcatccataatatttgacaacttcctctta |
2222844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University