View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18996_high_35 (Length: 233)
Name: NF18996_high_35
Description: NF18996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18996_high_35 |
 |  |
|
| [»] scaffold0743 (1 HSPs) |
 |  |  |
|
| [»] scaffold1819 (1 HSPs) |
 |  |  |
|
| [»] scaffold1104 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0743 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: scaffold0743
Description:
Target: scaffold0743; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 5 - 219
Target Start/End: Original strand, 3861 - 4075
Alignment:
| Q |
5 |
tccatttctccacggtcttcagttaagcaccttcaaaattttatctctcctccaacagttcgtcgtcttctaggtaacatattattattttcattgagct |
104 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| ||||| ||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||| |
|
|
| T |
3861 |
tccatttctccacggtcttcggttaaacactttcaagattttatctctcctccaacagttcgtcgtcttctaagtcacatattattatttgcattgagct |
3960 |
T |
 |
| Q |
105 |
tcaaattgatgcaaagatcaccagaagctcttggtaatgacaacaggttttcagcaacctctgttgaatcattacaaattatagtaatcttcttcatcat |
204 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||| ||||||||| || |||| |||||| ||||||| ||||||||||||||| |||||||||| |
|
|
| T |
3961 |
tcaaattgatgcaaagatcaccaaaagctcttggtactgataacaggtttgcaccaacttctgttaaatcattgcaaattatagtaatcgtcttcatcat |
4060 |
T |
 |
| Q |
205 |
ggtggctcttgttat |
219 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4061 |
ggtggctcttgttat |
4075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1819 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: scaffold1819
Description:
Target: scaffold1819; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 121 - 219
Target Start/End: Complemental strand, 1330 - 1232
Alignment:
| Q |
121 |
atcaccagaagctcttggtaatgacaacaggttttcagcaacctctgttgaatcattacaaattatagtaatcttcttcatcatggtggctcttgttat |
219 |
Q |
| |
|
|||||| |||||| |||||| |||||||| ||||||||| | ||| |||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
1330 |
atcaccggaagcttttggtactgacaacaagttttcagctgcttctattgaatcattacaaattatagtaaccctcttcatcatggtggctcttgttat |
1232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1104 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: scaffold1104
Description:
Target: scaffold1104; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 121 - 219
Target Start/End: Complemental strand, 2852 - 2754
Alignment:
| Q |
121 |
atcaccagaagctcttggtaatgacaacaggttttcagcaacctctgttgaatcattacaaattatagtaatcttcttcatcatggtggctcttgttat |
219 |
Q |
| |
|
|||||| |||||| |||||| |||||||| ||||||||| | ||| |||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
2852 |
atcaccggaagcttttggtactgacaacaagttttcagctgcttctattgaatcattacaaattatagtaaccctcttcatcatggtggctcttgttat |
2754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University