View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18996_high_41 (Length: 202)
Name: NF18996_high_41
Description: NF18996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18996_high_41 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 96 - 202
Target Start/End: Original strand, 37141220 - 37141326
Alignment:
| Q |
96 |
ttttttgatttggtttctgatcggtattatggtgatccgttatattactctagttaactatgatggccaatattaatcgaaccaatggatggaatggata |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37141220 |
ttttttgatttggtttctgatcggtattatggtgatccgttatattactctagttaactatgatggccaatcttaatcgaaccaatggatggaatggata |
37141319 |
T |
|
| Q |
196 |
tagattt |
202 |
Q |
| |
|
||||||| |
|
|
| T |
37141320 |
tagattt |
37141326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University