View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18996_low_13 (Length: 385)
Name: NF18996_low_13
Description: NF18996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18996_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 4e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 99 - 374
Target Start/End: Complemental strand, 374520 - 374222
Alignment:
| Q |
99 |
gttctcaaagtttatcaaaacttgggttttcagtcatttgttgagatttttgagccattcttttagacttaatt----------------------gtgg |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
374520 |
gttctcaaagtttatcaaaacttgggttttcagtcatttgttgagatttttgagccattcttttagacttaatttttgagtctgttagttcctattgtgg |
374421 |
T |
|
| Q |
177 |
gggtggtgaggatgtttatgaatgtttttattctcaaagtttgatagnnnnnnnnnnnnnn-ctctattgggttttaattttccttgtgtatttgttcct |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374420 |
gggtggtgaggatgtttatgaatgtttttattctcaaagtttgatagtttttatttttttttctctattgggttttaattttccttgtgtatttgttcct |
374321 |
T |
|
| Q |
276 |
tttgtgaatggtggggtgtttgtgccaattgaggaccttggaagttattgaagttagtaaattattaattttaattattgaattttgtttgttgatttt |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
374320 |
tttgtgaatggtggggtgtttgtgccaattgaggaccttggaagttattgaagttagtaatttatgaattttaattattgaattttgtttgttgatttt |
374222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University