View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18996_low_33 (Length: 253)
Name: NF18996_low_33
Description: NF18996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18996_low_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 394261 - 394504
Alignment:
| Q |
1 |
gggtgtttttattattgcatttttcatctaaaaattgtaaattttggtgggttttgtttattcttcgtaaaacaataatgggttcttcagaaaactttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
394261 |
gggtgtttttattattgcatttttcatctaaaaattgtaaattttggtgggttttgtttattcttcgtaaaacaataatgggttcttgagaaaactttta |
394360 |
T |
|
| Q |
101 |
aaaatcaaattttttatattggagtgtttctgtttaatgcatttttattcaaaaacgttggtgggttttgattattcttcatgaacaatcatgggttcta |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394361 |
aaaatcaaattttttatattggggtgtttctgtttaatgcatttttattcaaaaacgttggtgggttttgattattcttcatgaacaatcatgggttcta |
394460 |
T |
|
| Q |
201 |
gagaaaagttgtaaaaatcaaatttttatactatgttgatgatg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394461 |
gagaaaagttgtaaaaatcaaatttttatactatgttgatgatg |
394504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 19764808 - 19765054
Alignment:
| Q |
1 |
gggtgtttttattattgcatttttcatctaaaaattgtaaatttt--ggtgggttttgtttattcttcgtaaaacaataatgggttcttcagaaaacttt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
19764808 |
gggtgtttttattattgcatttttcatctaaaaattgtaatttttttggtgggttttgattattcttcataaaacaataatgggttcttgagaaaacttg |
19764907 |
T |
|
| Q |
99 |
taaaaatcaaatttt-ttatattggagtgtttctgtttaatgcatttttattcaaaaacgttggtgggttttgattattcttcatgaacaatcatgggtt |
197 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
19764908 |
taaaaatcaattttttttatattggggtgtttctgtttaatgcatttttattcaaaaacgttggtgggttttgattattcttcataaacaatcataggtt |
19765007 |
T |
|
| Q |
198 |
ctagagaaaagttgtaaaaatcaaatttttatactatgttgatgatg |
244 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19765008 |
ctagaaaaaagttgtaaaaatcaaatttttatactatgttgatgatg |
19765054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University