View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18997_high_10 (Length: 494)
Name: NF18997_high_10
Description: NF18997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18997_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 238 - 485
Target Start/End: Original strand, 15627258 - 15627506
Alignment:
| Q |
238 |
ggtgaatttgttatgctacaatattttttcttttataatatacactagaaacaaacaagttttcttgctattta-ttttctttgtagcattgtgttgtgt |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15627258 |
ggtgaatttgttatgctacaatattttttcttttataatatacactagaaacaaacaagttttcttgctatttaattttctttgtagcattgtgttgtgt |
15627357 |
T |
|
| Q |
337 |
gttccatctgactcatttcctctccacacatattatatgtaacacttgtgtctttacatgtcttgttgcttcttattcacttcgacctttgtccgtgttg |
436 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15627358 |
gttccatctgactcatttcctctccacacatattatatgtaacacttgtgtctttacatgtcttgttgcttcttattcacttcgacctttgtccttgttg |
15627457 |
T |
|
| Q |
437 |
tatccattccaacacaactataacccaaccgcactacttctgtctctgc |
485 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15627458 |
tatccattccaacacaactataacccaaccgcactacttctgtctctgc |
15627506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 15627048 - 15627115
Alignment:
| Q |
23 |
tgagttaagttcacggaactactaaacataaattttgttgtttatattcccatcaggagtaaatctccc |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15627048 |
tgagttaagttcacggaactactaaacataaattttgttgtttatattcccatca-gagtaaatctccc |
15627115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University