View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18997_high_20 (Length: 272)
Name: NF18997_high_20
Description: NF18997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18997_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 73 - 253
Target Start/End: Original strand, 20684556 - 20684736
Alignment:
| Q |
73 |
agtagtaatgcaaagactttgatgaaaaatgactaaccacaatattaatgcaagttgattgtcatagatggtgactgaacttttggtcgttcaaactgat |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20684556 |
agtagtaatgcaaagactttgatgaaaaatgactaaccacaatattaatgcaagttgattgtcatagatggtgactgaacttttggtcgttcaaactgat |
20684655 |
T |
 |
| Q |
173 |
tgattaagcatagagaaagatgataatgagactctttacctccacaacaaaatgaaggaaaatcgactacaataatagaca |
253 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
20684656 |
tgattaagcatagagaaagaagataatgagactctttacctccacaacaaaatgaaggaaaatcgattaaaataatagaca |
20684736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University