View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18998_high_11 (Length: 252)
Name: NF18998_high_11
Description: NF18998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18998_high_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 28928232 - 28927994
Alignment:
| Q |
18 |
tatgtgatttcaggtatatatcttctcaaaacatcaatgcatg----tcattatttttgtgaaattaatttcactattgtagtagattttgctctttatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28928232 |
tatgtgatttcaggtatatatcttctcaaaacatcaatgcatgcatgttattatttttgtgaaattaatttcactattgtagtagattttgctctttatg |
28928133 |
T |
 |
| Q |
114 |
tagtctcagcttaagattttcacaaactttaggtcatggtaattttcatgcat--atatttaggtaacttcaacatcaatatgcatgttatcattacgat |
211 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
28928132 |
tagtctcagctgaagattctcacaaactttaggtcatggtaattttcatgcatatatatttaggtatcttcaacatca--atgcatgttatcattacgat |
28928035 |
T |
 |
| Q |
212 |
catgatctactaacttgatcatagttataagcccttaaaac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28928034 |
catgatctactaacttgatcatagttataagcccttaaaac |
28927994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University