View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18998_high_12 (Length: 250)
Name: NF18998_high_12
Description: NF18998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18998_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 43210747 - 43210988
Alignment:
| Q |
1 |
atcgacaacaaaatttgtcgaccctttnnnnnnnnccaacaaaacatgggtaaaaatggtataataaagataaagtgttgaacatatgagtaattgcaat |
100 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43210747 |
atcgacaacaaaattcgtcgaccctttaaaaaaaaccaacaaaacatgggtaaaaatggtataataaagataaagtgttgaacatatgagtaattgcaat |
43210846 |
T |
|
| Q |
101 |
tcagtaacaatgcttttcttcggttttcgtatgccatcgtttgtaccattcatcattctccatgttttaagtaggttatccggcaaaaatgccccaaaca |
200 |
Q |
| |
|
| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| || ||||||| |
|
|
| T |
43210847 |
ttagtaacaatgcttttcgtcggttttcgtatgccatcgtttgtaccattcatcattctccatgttttaagtaggttatctggcgaaaaggctccaaaca |
43210946 |
T |
|
| Q |
201 |
tataatgttttcaacttattttaaagagcaatgcttcttatc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43210947 |
tataatgttttcaacttattttaaagagcaatgcttcttatc |
43210988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University