View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18998_low_15 (Length: 237)
Name: NF18998_low_15
Description: NF18998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18998_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 59 - 198
Target Start/End: Complemental strand, 26673064 - 26672922
Alignment:
| Q |
59 |
caaataagagggtcaaaagacaatcatctatttactc-ttagctacaagattgaagaatcgcttgcga--atttcatagcatataagagttacttgtcat |
155 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||| ||||| |||||||||| ||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
26673064 |
caaataggagggtcaaaagacaaccacctatttactccttagcaacaagattgaggaatctcttgcgagaatttcatagcatataagggttacttgtcat |
26672965 |
T |
|
| Q |
156 |
gtctagaaggggctccttagaagctcctagtactttacttaaa |
198 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
26672964 |
gtctagaaggggctcctcagaagctcctagtattttacttaaa |
26672922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 39
Target Start/End: Complemental strand, 26673101 - 26673069
Alignment:
| Q |
7 |
tcataagcccttcgatagatatttttggaacat |
39 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
26673101 |
tcataagcccttcgatagatatttatggaacat |
26673069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University