View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18999_low_14 (Length: 368)
Name: NF18999_low_14
Description: NF18999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18999_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 322; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 21 - 354
Target Start/End: Complemental strand, 36562880 - 36562547
Alignment:
| Q |
21 |
ggatgcacggaaactgtttgatgaaaaggctgagagagaaagtaaggttgaggagcttgagaaggatagggatttggctgtgaagaagtcgattgagtcg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36562880 |
ggatgcacggaaactgtttgatgaaaaggctgagagagaaagtaaggttgaggagcttgagaaggatagggatttggctgtgaagaagtcgattgagtcg |
36562781 |
T |
|
| Q |
121 |
atgaaggtgattgatgagttgaaggagaagattgatttggtggtgaaggagaagaatgatgctgagggtgtgaatagtactcaggacgtcaagatttcca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36562780 |
gtgaaggtgattgatgagttgaaggagaagattgatttggtggtgaaggagaagaatgatgctgagggtgtgaatagtactcaggacgtcaagatttcca |
36562681 |
T |
|
| Q |
221 |
atcttggacttgagttgcaacagcttaatgaggttttgaagagctcgcggaatgaagaggctgtgatgcgtgggaagattcgtgaaatggaggaaaccat |
320 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36562680 |
atcttggacttgagttgcagcagcttaatgaggttttgaagagctcgcggaatgaagaggctgtgatgcgtgggaagattcgtgaaatggaggaaactat |
36562581 |
T |
|
| Q |
321 |
tgaggttgctctggagaaggaaagggaaatgatg |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36562580 |
tgaggttgctctggagaaggaaagggaaatgatg |
36562547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 82 - 175
Target Start/End: Original strand, 952083 - 952176
Alignment:
| Q |
82 |
aaggatagggatttggctgtgaagaagtcgattgagtcgatgaaggtgattgatgagttgaaggagaagattgatttggtggtgaaggagaaga |
175 |
Q |
| |
|
||||||| ||||| || |||||| |||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
952083 |
aaggataaggattaggttgtgaataagttgtttgaatcgatgaaggtgattgatgagttgaaggagaagattgttttggtggtgtatgagaaga |
952176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University