View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18999_low_21 (Length: 258)
Name: NF18999_low_21
Description: NF18999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18999_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 32 - 203
Target Start/End: Complemental strand, 3752467 - 3752296
Alignment:
| Q |
32 |
accaacaccaaaccctagtagtgacaacactaacagtaacagcagcagcagtacaaagtgttttcagaattcagattgannnnnnncttgtcaaatgtat |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3752467 |
accaacaccaaaccctagtagtgacaacactaacagtaacagcagcagcagtacaaagtgttttcagaattcagattgatttttttcttgtcaaatgtat |
3752368 |
T |
 |
| Q |
132 |
taggctctcctacttcttctatgagatttgtcttttctcttccatcttcatagatgaatgaagtgttgcttg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3752367 |
taggctctcctacttcttctatgagatttgtcttttctcttccatcttcatcgatgaatgaagtgttgcttg |
3752296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 192
Target Start/End: Original strand, 26604316 - 26604355
Alignment:
| Q |
153 |
tgagatttgtcttttctcttccatcttcatagatgaatga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26604316 |
tgagatttgtcttttctcttccatcttcatagttgaatga |
26604355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 137 - 196
Target Start/End: Original strand, 25511169 - 25511227
Alignment:
| Q |
137 |
tctcctacttcttctatgagatttgtcttttctcttccatcttcatagatgaatgaagtg |
196 |
Q |
| |
|
|||||| |||||| | |||||||||| ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
25511169 |
tctcctccttcttatctgagatttgt-ttttctcttccatcttcatagttgaataaagtg |
25511227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 137 - 196
Target Start/End: Complemental strand, 31985505 - 31985447
Alignment:
| Q |
137 |
tctcctacttcttctatgagatttgtcttttctcttccatcttcatagatgaatgaagtg |
196 |
Q |
| |
|
|||||| |||||| | |||||||||| ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
31985505 |
tctcctccttcttatctgagatttgt-ttttctcttccatcttcatagttgaataaagtg |
31985447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University