View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18999_low_34 (Length: 230)
Name: NF18999_low_34
Description: NF18999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18999_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 32842720 - 32842917
Alignment:
| Q |
19 |
ccttaaattcttactatgtagtatttgcatcatcacccatcaatcacttgtgatggtgcaaccatacatatgtccaattctaaaatcataaataaatatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32842720 |
ccttaaattcttactatgtagtatttgcatcatcacccatcaatcccttgtgatggtgcaaccatacatatgtccaattctaaaatcataaataaatatt |
32842819 |
T |
 |
| Q |
119 |
gacaaagtaaaactagggaaaatagctttatttttatattatcttggttccagaatggaataactattaatagtatatgtgcatatctagcttcatct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32842820 |
gacaaagtaaaactagggaaaatagctttatttttatactatcttggttccggaatggaataactagtaatagtatatgtgcatatctagcttcatct |
32842917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University