View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18999_low_37 (Length: 226)

Name: NF18999_low_37
Description: NF18999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18999_low_37
NF18999_low_37
[»] chr3 (1 HSPs)
chr3 (143-198)||(8572108-8572163)


Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 198
Target Start/End: Original strand, 8572108 - 8572163
Alignment:
143 gtcttgacacaaattatacaactgtgctttaattttcttgcctttaattgtttcta 198  Q
    ||||||||| |||||||||||  | | |||||||||||||||||||||||||||||    
8572108 gtcttgacagaaattatacaaaagagatttaattttcttgcctttaattgtttcta 8572163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University