View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18999_low_38 (Length: 206)
Name: NF18999_low_38
Description: NF18999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18999_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 20 - 135
Target Start/End: Complemental strand, 229972 - 229857
Alignment:
| Q |
20 |
ctactccactctcatctcctccagcaactactccagctccagctcctgccaagcttaagagtaaagcccctgcattggcacctgtgctctcgccatcaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229972 |
ctactccactctcatctcctccagcaactactccagctcccgctcctgccaagcttaagagtaaagcccctgcattggcacctgtgctctcgccatcaga |
229873 |
T |
 |
| Q |
120 |
tgctcccgctcccgga |
135 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
229872 |
tgctcccgctcccgga |
229857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University