View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18999_low_39 (Length: 202)
Name: NF18999_low_39
Description: NF18999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18999_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 26 - 141
Target Start/End: Original strand, 3752464 - 3752579
Alignment:
| Q |
26 |
tggtcctctcaaaatgagcccaaattttatgacatgtctttaaaaaatgtgttaacaaagcttcgacacaaaaaggtaagaaagctggtgtgaaaagaaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3752464 |
tggtcctctcaaaatgagcccaaattttatgacatgtctttaaaaaatgtgttaacaaagcttcgacacaaaaaggtaagaaagctggtgtgaaaagaaa |
3752563 |
T |
 |
| Q |
126 |
ttaatacaaaacattg |
141 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3752564 |
ttaatacaaaacattg |
3752579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University