View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19001_high_27 (Length: 302)
Name: NF19001_high_27
Description: NF19001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19001_high_27 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 124 - 302
Target Start/End: Original strand, 12140972 - 12141150
Alignment:
| Q |
124 |
aaaaggtctcaacagtgcttatatgattatatctatacctttagaatcgttttcttggcacttatttcgcagaatgtcatgtgtgtttgttcttaatgga |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12140972 |
aaaaggtctcaacagtgcttatatgattatatctatacatttagaataattttcttggcacttatttcgcagaatgtcatgtgtgtttgttcttaatgga |
12141071 |
T |
 |
| Q |
224 |
ggcattaattttcacaatgttttgggtaacatattttaaattgaatttggcaattatcatggttgagtttgatttggtt |
302 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12141072 |
ggcattaattttcaccatgttttgggtaacttattttaaattgaatttggcaattatcatggttgagtttgatttggtt |
12141150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 3 - 75
Target Start/End: Original strand, 12140851 - 12140923
Alignment:
| Q |
3 |
gaaggatgctgctgtctttactgagttgggaactgatgcagcgggtaagagataaaccatcctgttgccattg |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12140851 |
gaaggatgctgctgtctttactgagttgggaactgatgcagcgggtaagagataaaccatcctgttgccattg |
12140923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University