View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19001_high_30 (Length: 279)
Name: NF19001_high_30
Description: NF19001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19001_high_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 39276177 - 39275906
Alignment:
| Q |
1 |
ctaaacattgctgcatctttccctttaaaatttatagatatataatgaagtataactaataaaaagttttggtagaattcttaaggatcatgacctagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276177 |
ctaaacattgctgcatctttccctttaaaatttatagatatataatgaagtataactaataaaaagttttggtagaattcttaaggatcatgacctagat |
39276078 |
T |
|
| Q |
101 |
attgcctgcccatcacaaatcttttnnnnnnnntgccaatcacaatcacaatgttttggttcttttt-cgggtgatccaatgatctatttttaagttggt |
199 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39276077 |
attgcc----catcacaaatcttttaaaaaaaatgccaatcacaatcacaatgttttggttcttttttcgggtgatccaatgatctatttttaagttggt |
39275982 |
T |
|
| Q |
200 |
tgtctcactaatatggcatcattgaggctgctgtcttaaatttggctaattaaacttaaaactatgttctgtgctg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39275981 |
tgtctcactaatatggcatcattgaggctgctgtcttaaatttggctaattaaacttaaaactatgttctgtgctg |
39275906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University