View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19001_high_46 (Length: 206)
Name: NF19001_high_46
Description: NF19001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19001_high_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 9e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 43618864 - 43618795
Alignment:
| Q |
1 |
aggtgcatcaacccttaaacaaaaatttcttcattgcaatattgcccccctaaatactagcaattgcgca |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43618864 |
aggtgcatcaacccttaaacaaaaatttcttcattgcaatattgcccccctaaatactagcaattgcgca |
43618795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 170 - 206
Target Start/End: Complemental strand, 43618721 - 43618685
Alignment:
| Q |
170 |
aggtgacatcattattaatctagaacacaaaaaccct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43618721 |
aggtgacatcattattaatctagaacacaaaaaccct |
43618685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University