View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19001_high_46 (Length: 206)

Name: NF19001_high_46
Description: NF19001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19001_high_46
NF19001_high_46
[»] chr8 (2 HSPs)
chr8 (1-70)||(43618795-43618864)
chr8 (170-206)||(43618685-43618721)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 9e-32; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 43618864 - 43618795
Alignment:
1 aggtgcatcaacccttaaacaaaaatttcttcattgcaatattgcccccctaaatactagcaattgcgca 70  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43618864 aggtgcatcaacccttaaacaaaaatttcttcattgcaatattgcccccctaaatactagcaattgcgca 43618795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 170 - 206
Target Start/End: Complemental strand, 43618721 - 43618685
Alignment:
170 aggtgacatcattattaatctagaacacaaaaaccct 206  Q
    |||||||||||||||||||||||||||||||||||||    
43618721 aggtgacatcattattaatctagaacacaaaaaccct 43618685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University