View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19001_low_32 (Length: 276)
Name: NF19001_low_32
Description: NF19001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19001_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 124 - 255
Target Start/End: Original strand, 55083802 - 55083921
Alignment:
| Q |
124 |
aaatgtcaaatcaatctcaagaatgaggaacttggtgcaactaagcagcatggactgggacatggaggatgatattgctgcaactacttcttggcaatcc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
55083802 |
aaatgtcaaatcaatctcaagaatgaggaacttggtgcaactaagcagcatgga------------ggaggatattgctgcaactacttcttggcaatcc |
55083889 |
T |
|
| Q |
224 |
tctattttctacttcatctcttccgcttatgc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55083890 |
tctattttctacttcatctcttccgcttatgc |
55083921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 16 - 108
Target Start/End: Original strand, 55083684 - 55083776
Alignment:
| Q |
16 |
aagattagttgagacttgagacaaagagcgcgggcgaaatccgggggtcgtgtctcagtctatgtggactgtctggtaaagtctacaatcttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
55083684 |
aagattagttgagacttgagacaaagagcgcgggcgaaatccgggggtcgtgtctcagtctatgtgaactgtctggtaaagtctacaaccttc |
55083776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University