View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19001_low_43 (Length: 237)
Name: NF19001_low_43
Description: NF19001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19001_low_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 9 - 220
Target Start/End: Complemental strand, 12314877 - 12314669
Alignment:
| Q |
9 |
gattatactaaagtcaagaaaacgaaatggtatcagaaagagggaatggcagttggcctttttagttttgttagctcgaggacattatattatgggttct |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12314877 |
gattataataaagtcaagaaaacgaaatggtatcagaaagagggaatggcagttggcctttttagttttgttagctcgaggacattatattatgggttct |
12314778 |
T |
 |
| Q |
109 |
ctttgttagtatttctatattgaaatcacctatgtacactctctcatactttccttgtcaattcttatgcaatccaaaactcattttatttctcacacat |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12314777 |
ctttgt---tatttctatattgaaatcacctatgtaccctctctcacactttccttgtcaattcttatgcaatccaaaactcattttatttctcacacat |
12314681 |
T |
 |
| Q |
209 |
gctagtaggttc |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12314680 |
gctagtaggttc |
12314669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University