View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19002_high_14 (Length: 327)
Name: NF19002_high_14
Description: NF19002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19002_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 44106071 - 44106205
Alignment:
| Q |
1 |
gatttggctataaaatagtggaatctgaaacagagtaaaaacaggggaatcagaaaacagagtattttgttaatatcccttattgcatgcacaaagtaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44106071 |
gatttggctataaaatagtggaatctgaaacagagtaaaaacagggtaatcagaaaacagagtattttgttaatatcccttattgcatgcacaaagtaaa |
44106170 |
T |
 |
| Q |
101 |
cagaaaaatgtgaaattttttacaacccaattgag |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44106171 |
cagaaaaatgtgaaattttttacaacccaattgag |
44106205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 242 - 313
Target Start/End: Original strand, 44106314 - 44106385
Alignment:
| Q |
242 |
cagaggaattcagagtccaaaaacaggggaaataagtttgaaaacctattgcaatgaaattttgtgggaaag |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44106314 |
cagaggaattcagagtccaaaaacaggggaaataagtttgaaaacctattgcaatgaaattttgtgggaaag |
44106385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University