View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19002_low_10 (Length: 378)
Name: NF19002_low_10
Description: NF19002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19002_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 369
Target Start/End: Complemental strand, 8437874 - 8437500
Alignment:
| Q |
1 |
tgcaaggatgaatggtgatgagtaagatagttgtatgcagtttttgagggacatggaagttgttcaggttcctacttttttgttcattagagatggtaag |
100 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437874 |
tgcaaggatgaatggtgatgagaatgatagttgtatgcagtttttgagggacatggaagttgttcaggttcctacttttttgttcattagagatggtaag |
8437775 |
T |
 |
| Q |
101 |
attgctggtaggtatgttggttcagggaaaggtgaactcattggtgaaattctcaggtaccaaggagttcgtgttacttatt------aaatcaaatcaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8437774 |
attgctggtaggtatgttggttcagggaaaggtgaactcattggtgaaattctcaggtaccaaggagttcgtgttacttattaaaatcaaatcaaatcaa |
8437675 |
T |
 |
| Q |
195 |
ttgcttgttcatgtttgtattgatcataaacnnnnnnnnnnnnnnnnnnnngttaaggatttgtctcactgatttcatttttcgaaagatatatccttat |
294 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437674 |
ttgcttgttcatgtgtgtattgatcataaacatatttttgtgagatatatagttaaggatttgtctcactgatttcatttttcgaaagatatatccttat |
8437575 |
T |
 |
| Q |
295 |
cttttttgtttactggcaatatatttccttgagaacaaaactaaactgttacacgtttcagcatacgctctctgc |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8437574 |
cttttttgtttactggcaatatatttccttgagaacaaaactaaactgttacacgtttcagcatacgccctctgc |
8437500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University