View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19002_low_25 (Length: 237)
Name: NF19002_low_25
Description: NF19002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19002_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 33 - 223
Target Start/End: Original strand, 303037 - 303229
Alignment:
| Q |
33 |
tcaaaaatgatgacatgacaaccacctgnnnnnnngtcctttaccttaatatatatccgagatagatccgcattactaggaagggcattgcacatttagt |
132 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303037 |
tcaaaaatgataacatgacaaccacctgtttttttgtcctttaccttaatatatatccgagatagatccgcattactaggaagggcattgcacatttagt |
303136 |
T |
|
| Q |
133 |
tgtttactgctgacgtcatccagttacataatgactatgatgtcatgtcatccatat--atttacacacacatggcacatctatggtcgttag |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
303137 |
tgtttgctgctgacgtcatccagttacataatgactatgatgtcatgtcatccatattcacacacacacacatggcacatctatggtcgttag |
303229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University