View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19002_low_26 (Length: 237)
Name: NF19002_low_26
Description: NF19002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19002_low_26 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 74 - 237
Target Start/End: Original strand, 28394786 - 28394949
Alignment:
| Q |
74 |
tctttcttcattacagcgggtgttctttgtaatggagatgtcgattgtccacagactatatgtaatcaattttctaattttaatccaaggtgtaatttag |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28394786 |
tctttcttcattacagcgggtgttctttgtaatggagatgtcgattgtccacagactatatgtaatcgattttctaattttaatccaaggtgtaatttag |
28394885 |
T |
|
| Q |
174 |
gttattgtatatgtgtcagaatgatgacatagattatgatagcaaaaatattatttatagattc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28394886 |
gttattgtatatgtgtcagaatgatgacatagattatgatagcaaaaatattatttatagattc |
28394949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University