View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19004_high_3 (Length: 241)
Name: NF19004_high_3
Description: NF19004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19004_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 45039103 - 45038873
Alignment:
| Q |
1 |
caattttaaccaataataatcatgtagtgcaagtcgagaaatacattgg---------gataaggtttgctcgattaaggagtttggaggactacagtga |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
45039103 |
caattttaaccaataataatcatgtagtgcaagttgagaaatacattggatacactgggataaggtttgctcaattaaggagtttggaggactacggtgc |
45039004 |
T |
 |
| Q |
92 |
gaaagtttaagaaatttaatttggtattgttaggaaaatgaggttggaggttgtactttgaccaaagttttggcggcaaaatatgaggttttagtgggtt |
191 |
Q |
| |
|
||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45039003 |
gaaggtttaagaaatttaatttggtattggtaggaaaatgaggttggaggttgtacattgaccaaagttttggcggcaaaatatgaggttttagtgggtt |
45038904 |
T |
 |
| Q |
192 |
gaattaggagaagagggaggaaggtgtcgac |
222 |
Q |
| |
|
|||||||||||| ||||||||||| |||||| |
|
|
| T |
45038903 |
gaattaggagaacagggaggaaggcgtcgac |
45038873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University