View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19004_low_4 (Length: 236)
Name: NF19004_low_4
Description: NF19004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19004_low_4 |
 |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0111 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0416 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0292 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 9)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 41 - 221
Target Start/End: Complemental strand, 28975102 - 28974922
Alignment:
| Q |
41 |
aataaaattttctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattct |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28975102 |
aataaaattttctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattct |
28975003 |
T |
 |
| Q |
141 |
ggcttagcnnnnnnnttaatggtaatgtgcggttagactcatccctaaaatcaaaggtgatttcacaccaattttcctttg |
221 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28975002 |
ggcttagcaaaaaaattaatggtaatgtgcggttagactcatccctaaaatcaaaggtgatttcacaccaattttcctttg |
28974922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 51 - 148
Target Start/End: Complemental strand, 43848183 - 43848086
Alignment:
| Q |
51 |
tctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggcttagc |
148 |
Q |
| |
|
|||||||| ||||| ||||||| ||||| ||| ||||||||||||||||||||||| |||||||||||||||||||| |||||| | |||||||||| |
|
|
| T |
43848183 |
tctgagattggcggcataggatgagggttctgcggggtgccaacctagttgggatgttgttgcttccccttgatgcctgtccaatctcctggcttagc |
43848086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 55 - 146
Target Start/End: Complemental strand, 40263733 - 40263642
Alignment:
| Q |
55 |
agatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggctta |
146 |
Q |
| |
|
|||| ||||| ||||||| |||||| ||||||||||||||||||||||||||| |||||||| || |||||||| |||||| | |||||||| |
|
|
| T |
40263733 |
agattggcggcataggatgggggttctgcagggtgccaacctagttgggatgttgttgcttcaccctgatgcctgtccaatctcctggctta |
40263642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 147
Target Start/End: Complemental strand, 17275668 - 17275573
Alignment:
| Q |
51 |
tctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggcttag |
147 |
Q |
| |
|
|||||||| || || ||||||| |||||| ||| |||||||| | ||||||||||||||||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
17275668 |
tctgagattggtggtataggatgggggttctgcggggtgcca-cttagttgggatgtcgttgcttcccgttgatgcctgtccaatatcctggcttag |
17275573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 128
Target Start/End: Original strand, 43856140 - 43856192
Alignment:
| Q |
76 |
ggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcct |
128 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43856140 |
ggttctgcggggtgccaacctagttgggatgtcgttacttccccttgatgcct |
43856192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 85 - 127
Target Start/End: Complemental strand, 15646120 - 15646078
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgcc |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
15646120 |
gggtgccaacctagttgggatgtcgtttcttctccttgatgcc |
15646078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 85 - 135
Target Start/End: Original strand, 29043202 - 29043252
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaat |
135 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||| | |||||| |
|
|
| T |
29043202 |
gggtgccaacctagtttggatgtcgttgcttccccctgatgcttgtccaat |
29043252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 127
Target Start/End: Complemental strand, 15622349 - 15622307
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgcc |
127 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
15622349 |
gggtgccaacctagttgggatgtcgtttcttatccttgatgcc |
15622307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 41 - 135
Target Start/End: Complemental strand, 17279222 - 17279127
Alignment:
| Q |
41 |
aataaaattttct--gagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaat |
135 |
Q |
| |
|
||||||||||||| ||||| || || ||||||| |||||| ||| |||||||| | ||||||||||| ||||||||| ||||||||| |||||| |
|
|
| T |
17279222 |
aataaaattttctctgagattggtggtataggatgggggttctgcggggtgccatc-tagttgggatgccgttgcttctttttgatgcctgtccaat |
17279127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 16)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 41 - 148
Target Start/End: Complemental strand, 33064913 - 33064804
Alignment:
| Q |
41 |
aataaaattttct--gagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatatt |
138 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
33064913 |
aataaaattttctctgagattggcggtataggatgggggttctgcggggtgccaacctagttgggatgtcgttgcttccccttgatgcctgtccaatctc |
33064814 |
T |
 |
| Q |
139 |
ctggcttagc |
148 |
Q |
| |
|
|||||||||| |
|
|
| T |
33064813 |
ctggcttagc |
33064804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 51 - 135
Target Start/End: Original strand, 8983801 - 8983885
Alignment:
| Q |
51 |
tctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaat |
135 |
Q |
| |
|
|||||||| ||| | ||||||| |||||| |||||||||||||||||||| |||||| ||||||||||| ||||||||||||||| |
|
|
| T |
8983801 |
tctgagattggctgcataggatgggggttctgcagggtgccaacctagtttggatgttgttgcttccccctgatgcctatccaat |
8983885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 41 - 133
Target Start/End: Complemental strand, 15318171 - 15318080
Alignment:
| Q |
41 |
aataaaattttctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatcca |
133 |
Q |
| |
|
|||||||||| |||| | ||||| ||||||| |||||| ||| ||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15318171 |
aataaaatttcttgagtttggcggcataggatgggggttctgc-gggtgccaatctagttgggatgtcgtttcttccccttgatgcctatcca |
15318080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 51 - 148
Target Start/End: Original strand, 41917075 - 41917173
Alignment:
| Q |
51 |
tctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgctt-ccccttgatgcctatccaatattctggcttagc |
148 |
Q |
| |
|
|||||||| | ||| ||||||| |||||| | | ||||||||||||||||||||||| ||||||| ||||||||||||| |||||| | |||||||||| |
|
|
| T |
41917075 |
tctgagattgacggcataggatgggggttctccggggtgccaacctagttgggatgttgttgcttcccccttgatgcctgtccaatctcctggcttagc |
41917173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 48 - 125
Target Start/End: Original strand, 17122823 - 17122900
Alignment:
| Q |
48 |
ttttctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
||||||||| | ||||| ||||||| ||||| ||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17122823 |
ttttctgagtttggcggcataggatgagggttctgcggggtgccaacctagttgggatgtcgttgcttctccttgatg |
17122900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 142
Target Start/End: Original strand, 27534239 - 27534331
Alignment:
| Q |
50 |
ttctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctgg |
142 |
Q |
| |
|
||||||| | ||||| ||||||| ||||| |||||||| |||| ||||||||||| |||||| ||||||||||||||| |||| | |||||| |
|
|
| T |
27534239 |
ttctgagtttggcggcataggatgtgggttctgcagggtaccaatctagttgggatatcgttgtttccccttgatgcctgtccattcttctgg |
27534331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 146
Target Start/End: Complemental strand, 21487917 - 21487822
Alignment:
| Q |
51 |
tctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggctta |
146 |
Q |
| |
|
|||||| | ||||| ||||||| |||||| | | |||||||||||||||||||||||||| ||||| |||||||||| |||| | | |||||||| |
|
|
| T |
21487917 |
tctgagtttggcggcataggatgggggttcttcggggtgccaacctagttgggatgtcgtcacttcctcttgatgcctgtccactctcctggctta |
21487822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 85 - 128
Target Start/End: Original strand, 24230212 - 24230255
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgcct |
128 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24230212 |
gggtgtcaacctagttgggatgtcgttgcttctccttgatgcct |
24230255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 86 - 125
Target Start/End: Original strand, 33012786 - 33012825
Alignment:
| Q |
86 |
ggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33012786 |
ggtgccaacctagttgggatgtcgttgcttctccttgatg |
33012825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 125
Target Start/End: Complemental strand, 31721008 - 31720970
Alignment:
| Q |
86 |
ggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31721008 |
ggtgccaacctagttgggatgtcgttgc-tccccttgatg |
31720970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 147
Target Start/End: Original strand, 19274274 - 19274336
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggcttag |
147 |
Q |
| |
|
|||||||||||||||||||| |||| |||| |||||||||||| ||||| | ||||||||| |
|
|
| T |
19274274 |
gggtgccaacctagttgggaattcgtcgcttgcccttgatgcctcaccaatctcctggcttag |
19274336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 131
Target Start/End: Original strand, 30109394 - 30109440
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgcctatc |
131 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||| ||| ||||| |
|
|
| T |
30109394 |
gggtgccaacctaattgagatgtcgttgcttccccttaatgtctatc |
30109440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 127
Target Start/End: Complemental strand, 34528966 - 34528924
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgcc |
127 |
Q |
| |
|
||||||||||||||||||||||||| || |||| ||||||||| |
|
|
| T |
34528966 |
gggtgccaacctagttgggatgtcgctgtttcctcttgatgcc |
34528924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 85 - 126
Target Start/End: Complemental strand, 19054432 - 19054391
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
||||||||||||||||||||||||| || |||| |||||||| |
|
|
| T |
19054432 |
gggtgccaacctagttgggatgtcggtgtttcctcttgatgc |
19054391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 86 - 126
Target Start/End: Original strand, 10433229 - 10433269
Alignment:
| Q |
86 |
ggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| |||||||| |
|
|
| T |
10433229 |
ggtgcaaacctagttgggatgtcggtgcttcctcttgatgc |
10433269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 133
Target Start/End: Complemental strand, 13309426 - 13309378
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgcctatcca |
133 |
Q |
| |
|
||||||||||||||||||||||||| || | || |||||||||| |||| |
|
|
| T |
13309426 |
gggtgccaacctagttgggatgtcgatgatgcctcttgatgcctgtcca |
13309378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 6e-24; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 135
Target Start/End: Complemental strand, 38993178 - 38993094
Alignment:
| Q |
51 |
tctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaat |
135 |
Q |
| |
|
|||||||| ||||| ||||||| |||||| ||| ||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
38993178 |
tctgagattggcggcataggatgggggttctgcggggtgccaacctagttgggatgtcgttgcttccccctgatgcctgtccaat |
38993094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 53 - 148
Target Start/End: Original strand, 20382332 - 20382427
Alignment:
| Q |
53 |
tgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggcttagc |
148 |
Q |
| |
|
|||||| ||||| ||||||| |||||| ||| ||||||||||||||||||||||| ||||||||||| |||||||||| |||| | |||||||||| |
|
|
| T |
20382332 |
tgagattggcggcataggatgggggttctgcggggtgccaacctagttgggatgttgttgcttccccctgatgcctattcaatctcctggcttagc |
20382427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 85 - 126
Target Start/End: Original strand, 37375040 - 37375081
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37375040 |
gggtgccaacctagttgggatgtcgtcgcttccccttgatgc |
37375081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 83 - 125
Target Start/End: Complemental strand, 17354829 - 17354787
Alignment:
| Q |
83 |
cagggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
17354829 |
cagggtgctaacctagttgggatgttgttgcttccccttgatg |
17354787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 120
Target Start/End: Complemental strand, 11292608 - 11292543
Alignment:
| Q |
55 |
agatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttcccct |
120 |
Q |
| |
|
|||| ||||| ||||||| |||||| ||| ||||||||| |||||| |||||| |||||||||||| |
|
|
| T |
11292608 |
agattggcggcataggatgggggttctgcggggtgccaatctagttaggatgttgttgcttcccct |
11292543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 13)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 51 - 148
Target Start/End: Complemental strand, 38499931 - 38499834
Alignment:
| Q |
51 |
tctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggcttagc |
148 |
Q |
| |
|
|||||||| ||||| ||||||| ||||| ||| ||||||||||||||||||||||| ||||||||||| |||||||| |||||| | |||||||||| |
|
|
| T |
38499931 |
tctgagattggcggcataggatgagggttttgcggggtgccaacctagttgggatgttgttgcttccccctgatgcctgtccaatctcctggcttagc |
38499834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 61 - 135
Target Start/End: Original strand, 13242195 - 13242269
Alignment:
| Q |
61 |
gcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaat |
135 |
Q |
| |
|
|||| ||||||| |||||| ||| |||||||||||||||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
13242195 |
gcggtataggatgggggttctgcggggtgccaacctagtttggatgccgttgcttccccttgatgcctgtccaat |
13242269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 41 - 133
Target Start/End: Complemental strand, 44673766 - 44673674
Alignment:
| Q |
41 |
aataaaattttctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatcca |
133 |
Q |
| |
|
||||||||||| ||| | ||||| ||||||| | | || ||| ||||||||||||||||||||||||| || | || ||||||| ||||||| |
|
|
| T |
44673766 |
aataaaatttttagagtttggcggcataggatggagattttgcggggtgccaacctagttgggatgtcgatgttgcctcttgatgtctatcca |
44673674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 66 - 125
Target Start/End: Complemental strand, 42805702 - 42805644
Alignment:
| Q |
66 |
ataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
||||||| || ||| ||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
42805702 |
ataggatgggagttctgcggggtgccaacctagttggg-tgtcgctgcttccccttgatg |
42805644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 126
Target Start/End: Complemental strand, 39117289 - 39117219
Alignment:
| Q |
56 |
gatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
||||||||| | ||||| |||||| | ||||| ||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
39117289 |
gatcggcggtagaggatgggggttcatcggggtgtcaatctagttgggatgttgttgcttccccttgatgc |
39117219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 125
Target Start/End: Original strand, 12714267 - 12714300
Alignment:
| Q |
92 |
aacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
12714267 |
aacctagttgggatatcgttgcttccccttgatg |
12714300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 87 - 128
Target Start/End: Complemental strand, 13030205 - 13030164
Alignment:
| Q |
87 |
gtgccaacctagttgggatgtcgttgcttccccttgatgcct |
128 |
Q |
| |
|
|||||||||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
13030205 |
gtgccaacctagttaggatgtcgttacttctccttgatgcct |
13030164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 85 - 126
Target Start/End: Complemental strand, 34657960 - 34657919
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
||||||||||||||||||||||||| || |||| |||||||| |
|
|
| T |
34657960 |
gggtgccaacctagttgggatgtcggtgtttcctcttgatgc |
34657919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 85 - 126
Target Start/End: Complemental strand, 37005948 - 37005907
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| |||||||| |
|
|
| T |
37005948 |
gggtgccaacctaattgggatgtcggtgcttcctcttgatgc |
37005907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 148
Target Start/End: Complemental strand, 10703866 - 10703802
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgctt-ccccttgatgcctatccaatattctggcttagc |
148 |
Q |
| |
|
||||||||| |||||||||||||| |||||| |||| |||||||| |||||| | ||||||||| |
|
|
| T |
10703866 |
gggtgccaatctagttgggatgtcattgcttcccccctgatgcctgtccaatctcatggcttagc |
10703802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 148
Target Start/End: Complemental strand, 10917636 - 10917572
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgctt-ccccttgatgcctatccaatattctggcttagc |
148 |
Q |
| |
|
||||||||| |||||||||||||| |||||| |||| |||||||| |||||| | ||||||||| |
|
|
| T |
10917636 |
gggtgccaatctagttgggatgtcattgcttcccccctgatgcctgtccaatctcatggcttagc |
10917572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 133
Target Start/End: Original strand, 34512091 - 34512139
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgcctatcca |
133 |
Q |
| |
|
||||||||||||||||||||||||| || | || |||||||||| |||| |
|
|
| T |
34512091 |
gggtgccaacctagttgggatgtcgatgatgcctcttgatgcctgtcca |
34512139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 126
Target Start/End: Complemental strand, 42227192 - 42227160
Alignment:
| Q |
94 |
cctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
42227192 |
cctagttgggatgttgttgcttccccttgatgc |
42227160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 11)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 53 - 148
Target Start/End: Complemental strand, 27206461 - 27206366
Alignment:
| Q |
53 |
tgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggcttagc |
148 |
Q |
| |
|
|||||| | ||| ||||||| |||||| ||| ||||||||||||||||||||||| ||||||||||| |||||||| |||||| | |||||||||| |
|
|
| T |
27206461 |
tgagattgacggcataggatgggggttctgcggggtgccaacctagttgggatgttgttgcttccccctgatgcctgtccaatctcctggcttagc |
27206366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 66 - 148
Target Start/End: Complemental strand, 20374183 - 20374101
Alignment:
| Q |
66 |
ataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggcttagc |
148 |
Q |
| |
|
||||||| |||||| ||| ||||| ||||||||||||||||||||||||||||||||||| || |||||| | | |||||||| |
|
|
| T |
20374183 |
ataggatgggggttctgcggggtggcaacctagttgggatgtcgttgcttccccttgatgtctgtccaatctcccggcttagc |
20374101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 41 - 148
Target Start/End: Complemental strand, 20434275 - 20434166
Alignment:
| Q |
41 |
aataaaatttt--ctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatatt |
138 |
Q |
| |
|
||||||||||| ||||| | ||||| ||||||| |||||| ||| ||||||||||||||||| |||||||||| || ||||| |||| | |||||| | |
|
|
| T |
20434275 |
aataaaattttatctgagtttggcggcataggatgggggttttgcggggtgccaacctagttgtgatgtcgttgtttacccttaatgcatgtccaatctc |
20434176 |
T |
 |
| Q |
139 |
ctggcttagc |
148 |
Q |
| |
|
| |||||||| |
|
|
| T |
20434175 |
ccggcttagc |
20434166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 85 - 125
Target Start/End: Complemental strand, 3914292 - 3914252
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3914292 |
gggtgccaacctagttgggatgtcgttgcttctccttgatg |
3914252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 85 - 125
Target Start/End: Original strand, 44395789 - 44395829
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44395789 |
gggtaccaacctagttgggatgtcgttgcttctccttgatg |
44395829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 85 - 116
Target Start/End: Complemental strand, 16109997 - 16109966
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16109997 |
gggtgccaacctagttgggatgtcgttgcttc |
16109966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 125
Target Start/End: Complemental strand, 22266373 - 22266334
Alignment:
| Q |
86 |
ggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22266373 |
ggtgtcaacctagttgggatgtcgttgcttccccctgatg |
22266334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 87 - 128
Target Start/End: Original strand, 11938936 - 11938977
Alignment:
| Q |
87 |
gtgccaacctagttgggatgtcgttgcttccccttgatgcct |
128 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
11938936 |
gtgccaacctagttgcgatatcgtttcttccccttgatgcct |
11938977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 87 - 128
Target Start/End: Complemental strand, 24474836 - 24474795
Alignment:
| Q |
87 |
gtgccaacctagttgggatgtcgttgcttccccttgatgcct |
128 |
Q |
| |
|
|||||||| |||||||||||||| |||||| ||||||||||| |
|
|
| T |
24474836 |
gtgccaacatagttgggatgtcgatgcttctccttgatgcct |
24474795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 132
Target Start/End: Complemental strand, 13198195 - 13198123
Alignment:
| Q |
60 |
ggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatcc |
132 |
Q |
| |
|
||||| ||||||| |||||| | | |||| ||| ||| ||||||||||||||||||||||| |||| ||||| |
|
|
| T |
13198195 |
ggcggcataggatgggggttcttcgaggtgtcaatctaattgggatgtcgttgcttccccttaatgcatatcc |
13198123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 125
Target Start/End: Original strand, 28522851 - 28522923
Alignment:
| Q |
53 |
tgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
|||||| ||||| ||||||| | |||| | ||||||||||||||||||||||||| || |||| ||||||| |
|
|
| T |
28522851 |
tgagattggcggcataggatggaggttctctagggtgccaacctagttgggatgtcaatgtttcctcttgatg |
28522923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 51 - 148
Target Start/End: Complemental strand, 3473 - 3376
Alignment:
| Q |
51 |
tctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggcttagc |
148 |
Q |
| |
|
|||||||| ||||| ||||||| |||||| ||| | ||||||||||||||||||||| ||||||||||| |||||||| |||||| | ||||||||| |
|
|
| T |
3473 |
tctgagattggcggcataggatgggggttctgcggagtgccaacctagttgggatgttgttgcttccccctgatgcctgtccaatctcttggcttagc |
3376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 9e-20; HSPs: 10)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 66 - 147
Target Start/End: Complemental strand, 22602097 - 22602016
Alignment:
| Q |
66 |
ataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggcttag |
147 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||||||||||| |||||||||||| || |||||| ||||| ||||| |
|
|
| T |
22602097 |
ataggatgggggttctgcggggtgccaacctagttgggatgtcgttgattccccttgatgtctgtccaatcttctgccttag |
22602016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 111
Target Start/End: Complemental strand, 21027109 - 21027037
Alignment:
| Q |
41 |
aataaaatttt--ctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgtt |
111 |
Q |
| |
|
||||||||||| ||||| | ||||| ||||||| |||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
21027109 |
aataaaattttatctgagtttggcggcataggatgggggttctgcggggtgccaacctagttgggatgtcgtt |
21027037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 85 - 126
Target Start/End: Original strand, 28637649 - 28637690
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28637649 |
gggtgccaacctagttgggatgtcgtcgcttccccttgatgc |
28637690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 85 - 125
Target Start/End: Original strand, 16987843 - 16987883
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16987843 |
gggtgccaacctagttgggatgtcgttgcttctccttgatg |
16987883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 86 - 126
Target Start/End: Complemental strand, 31552444 - 31552404
Alignment:
| Q |
86 |
ggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31552444 |
ggtgccaacctagttgggatgtcgttgcttctccttgatgc |
31552404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 85 - 148
Target Start/End: Original strand, 31792592 - 31792654
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggcttagc |
148 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||| ||||| | |||||||||| |
|
|
| T |
31792592 |
gggtgccaacctagttgggatgtcgtcgcttcccc-tgatgcctcaccaatgtcctggcttagc |
31792654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 86 - 123
Target Start/End: Complemental strand, 18191247 - 18191210
Alignment:
| Q |
86 |
ggtgccaacctagttgggatgtcgttgcttccccttga |
123 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
18191247 |
ggtgccaacctagtttggatgtcgtcgcttccccttga |
18191210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 125
Target Start/End: Original strand, 4809193 - 4809229
Alignment:
| Q |
89 |
gccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
4809193 |
gccaacctagttaggaggtcgttgcttccccttgatg |
4809229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 125
Target Start/End: Original strand, 17764947 - 17764987
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
||||||||| ||| |||||||||||||||||| |||||||| |
|
|
| T |
17764947 |
gggtgccaatctaattgggatgtcgttgcttctccttgatg |
17764987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 125
Target Start/End: Original strand, 35358628 - 35358667
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
35358628 |
gggtgccaacctagttgggatgccgttgc-tccccttgatg |
35358667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 4e-19; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 44 - 148
Target Start/End: Complemental strand, 13580244 - 13580140
Alignment:
| Q |
44 |
aaaattttctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggc |
143 |
Q |
| |
|
|||| |||||||| | ||||| ||||||| |||||| | | ||||||||||||| | ||||||||||||||| |||||||||||| |||||| | ||||| |
|
|
| T |
13580244 |
aaaaatttctgaggttggcggcataggatgggggttctacggggtgccaacctaatggggatgtcgttgctttcccttgatgcctgtccaatctcctggc |
13580145 |
T |
 |
| Q |
144 |
ttagc |
148 |
Q |
| |
|
||||| |
|
|
| T |
13580144 |
ttagc |
13580140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 53 - 133
Target Start/End: Complemental strand, 34673154 - 34673074
Alignment:
| Q |
53 |
tgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatcca |
133 |
Q |
| |
|
|||||| ||||| ||||||| |||||| ||| |||| ||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
34673154 |
tgagattggcggtataggatgggggttctgcgaggtgtcaacctagttgggatgtcgttgctttcccttgatgtctatcca |
34673074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 85 - 126
Target Start/End: Complemental strand, 7242922 - 7242881
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
7242922 |
gggtgccaacctagttgggatgtcgtcgcttcctcttgatgc |
7242881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 53 - 126
Target Start/End: Original strand, 24373514 - 24373587
Alignment:
| Q |
53 |
tgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
|||||| ||||| ||||||| | |||| | |||||| ||||||||||||||||||| ||||||| | |||||| |
|
|
| T |
24373514 |
tgagattggcggcataggatggaggttctccagggtaccaacctagttgggatgtcagtgcttcctcgtgatgc |
24373587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 85 - 126
Target Start/End: Complemental strand, 24617780 - 24617739
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
||||||||||||||||||||||||| || |||| |||||||| |
|
|
| T |
24617780 |
gggtgccaacctagttgggatgtcggtgtttcctcttgatgc |
24617739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 85 - 126
Target Start/End: Original strand, 30884431 - 30884472
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
||||| |||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
30884431 |
gggtgtcaacctagttgggatgtcgttgattctccttgatgc |
30884472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 86 - 126
Target Start/End: Complemental strand, 15050082 - 15050042
Alignment:
| Q |
86 |
ggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
|||||||||||||||||||| |||||| |||| |||||||| |
|
|
| T |
15050082 |
ggtgccaacctagttgggatatcgttgtttcctcttgatgc |
15050042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 125
Target Start/End: Complemental strand, 34338141 - 34338101
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
||||||||||||||||||||||||| || |||| ||||||| |
|
|
| T |
34338141 |
gggtgccaacctagttgggatgtcgatgattcctcttgatg |
34338101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0111 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0111
Description:
Target: scaffold0111; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 41 - 148
Target Start/End: Complemental strand, 41328 - 41219
Alignment:
| Q |
41 |
aataaaatttt--ctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatatt |
138 |
Q |
| |
|
||||||||||| ||||| | ||||| ||||||| ||||| ||| ||||||||||||||||||||| |||||||||||||||||||| | |||||| | |
|
|
| T |
41328 |
aataaaattttatctgagtttggcggcataggatgagggttctgcggggtgccaacctagttgggatttcgttgcttccccttgatgcatgtccaatctc |
41229 |
T |
 |
| Q |
139 |
ctggcttagc |
148 |
Q |
| |
|
| |||||||| |
|
|
| T |
41228 |
ccggcttagc |
41219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 51 - 148
Target Start/End: Original strand, 160303 - 160400
Alignment:
| Q |
51 |
tctgagatcggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggcttagc |
148 |
Q |
| |
|
|||||||| ||||| |||| || |||||| ||| ||||| ||||||||||||||||||||||||||||| |||||| |||||| | |||||||||| |
|
|
| T |
160303 |
tctgagattggcggcatagaatgggggttctgcggggtggcaacctagttgggatgtcgttgcttccccctgatgcaggtccaatctcctggcttagc |
160400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 75 - 133
Target Start/End: Complemental strand, 146034 - 145976
Alignment:
| Q |
75 |
gggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatcca |
133 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
146034 |
gggttatgcggggtagcaacctagttgggatgtcgttgcttccccttgatgcctgtcca |
145976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 66 - 148
Target Start/End: Original strand, 20952400 - 20952482
Alignment:
| Q |
66 |
ataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaatattctggcttagc |
148 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||||||||||||||||| ||||||| |||||| | |||||| | ||||||||| |
|
|
| T |
20952400 |
ataggatgggggttctgcggggtgccaacctagttgggatgtcgttacttccccctgatgcttgtccaatctcatggcttagc |
20952482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 85 - 128
Target Start/End: Original strand, 19185107 - 19185150
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgcct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19185107 |
gggtgccaacctagttgggatgtcgttgcttctccttgatgcct |
19185150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 83 - 126
Target Start/End: Complemental strand, 27310781 - 27310738
Alignment:
| Q |
83 |
cagggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27310781 |
cagggtgccaacctagttgggttgtcgttgcttccccttgatgc |
27310738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 66 - 135
Target Start/End: Complemental strand, 10287741 - 10287672
Alignment:
| Q |
66 |
ataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcctatccaat |
135 |
Q |
| |
|
||||||| || ||| ||| |||||||||||||||||||||| | ||||||||||||||||| | |||||| |
|
|
| T |
10287741 |
ataggatgggagttttgcggggtgccaacctagttgggatgccattgcttccccttgatgcgtgtccaat |
10287672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 86 - 127
Target Start/End: Complemental strand, 27636946 - 27636905
Alignment:
| Q |
86 |
ggtgccaacctagttgggatgtcgttgcttccccttgatgcc |
127 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27636946 |
ggtgtcaacctagttgggatgtcgttgcttccccttgatgcc |
27636905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 127
Target Start/End: Complemental strand, 27640041 - 27639974
Alignment:
| Q |
60 |
ggcggaataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatgcc |
127 |
Q |
| |
|
|||||| |||||| ||||||| | ||||| ||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
27640041 |
ggcggagtaggatgggggttaatcggggtgtcaacctagttgcgatgtcgttgcttccctttgatgcc |
27639974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 125
Target Start/End: Original strand, 26934871 - 26934910
Alignment:
| Q |
86 |
ggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
26934871 |
ggtgccaacctaattgggatgtcgtcgcttccccttgatg |
26934910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0416 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0416
Description:
Target: scaffold0416; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 85 - 126
Target Start/End: Original strand, 14841 - 14882
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14841 |
gggtgccaacctagttgggatgtcgttgcttctccttgatgc |
14882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 66 - 125
Target Start/End: Complemental strand, 617 - 559
Alignment:
| Q |
66 |
ataggattggggttatgcagggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
||||||| |||||| ||| ||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
617 |
ataggatgggggttctgc-gggtgccaagctagttgggatgtcgctgcttccccttgatg |
559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 125
Target Start/End: Complemental strand, 118707 - 118665
Alignment:
| Q |
83 |
cagggtgccaacctagttgggatgtcgttgcttccccttgatg |
125 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
118707 |
cagggttccaacctagttgggatgtcgttgcttcttcttgatg |
118665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0292 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0292
Description:
Target: scaffold0292; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 133
Target Start/End: Original strand, 21251 - 21299
Alignment:
| Q |
85 |
gggtgccaacctagttgggatgtcgttgcttccccttgatgcctatcca |
133 |
Q |
| |
|
||||||||||||||||||||||||| || | || |||||||||| |||| |
|
|
| T |
21251 |
gggtgccaacctagttgggatgtcgatgatgcctcttgatgcctgtcca |
21299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University