View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19004_low_5 (Length: 227)
Name: NF19004_low_5
Description: NF19004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19004_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 211
Target Start/End: Original strand, 26137802 - 26137990
Alignment:
| Q |
20 |
ggaccgtggtccatttggtcatattaggttaccacgatgacggctgattcatatagacaatcttataaccaccaggtggaaacaattcaagaggatacta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
26137802 |
ggaccgtggtccatttggtcatattaggttaccacgatgatggctgattcatatagacaatcttataaccaccaggtggaaacaattcaagatgatgcta |
26137901 |
T |
 |
| Q |
120 |
tgaaaaagaagnnnnnnnnttggtttgcagatttccggactccttagagtaagttctttatttgattgttgcctactcgcccatattttcat |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26137902 |
tgaaaaagaa---ataaaattggtttgcagatttccggactccttacagtaagttctttatttgattgtcgcctactcgcccatattttcat |
26137990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University