View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19005_high_12 (Length: 359)
Name: NF19005_high_12
Description: NF19005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19005_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 49 - 349
Target Start/End: Complemental strand, 46434302 - 46434002
Alignment:
| Q |
49 |
aaagctatagattttacaaagtatctattgatgaaatttaaaatgcaactttaagcatgtctaagtttataaacgatatagtatatctgtgaaatatgtg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46434302 |
aaagctatagattttacaaagtatctattgatgaaatttaaaatgcaactttaagcatgtctaagtttataaacgatatagtatatctgtgaaatatgtg |
46434203 |
T |
|
| Q |
149 |
tcttctcgctgatgtggattcccatggttgacatagatgtctttgttgtcggggtgcatcccttcgttctacgaattgtcctgtctaaagcaaactgtct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46434202 |
tcttctcgctgatgtggattcccatggttgacatagatgtctttgttgtcggggtgcatccctacgttctacgaattgtcctgtctaaagcaaactgtct |
46434103 |
T |
|
| Q |
249 |
gcacgttcaattttgtcttgctccaaacttttctccaccttttctctcatggataacatcccttcgaatccatgttcaaatagttctctccgtgctttca |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46434102 |
gcacgttcaattttgtcttgctccaaacttttctccaccttttctctcatggataacatcccttcgaatccatgttcaaatagttctctccgtgctttca |
46434003 |
T |
|
| Q |
349 |
t |
349 |
Q |
| |
|
| |
|
|
| T |
46434002 |
t |
46434002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 7 - 40
Target Start/End: Complemental strand, 46434358 - 46434325
Alignment:
| Q |
7 |
ctaacctctgaagtgatccatataggcaaagtcc |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46434358 |
ctaacctctgaagtgatccatataggcaaagtcc |
46434325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University