View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19005_high_24 (Length: 248)
Name: NF19005_high_24
Description: NF19005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19005_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 50088402 - 50088182
Alignment:
| Q |
18 |
caatcatgattggtgtttccattgaattaatacgtttaggcccaaatgaaatcctcaatctttggaactcactaaacttaaaccttgttcaaatcctatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50088402 |
caatcatgattggtgtttccattgaattaatacgtttaggcccaaatgaaatcctcaatctttggaactcactaaacttaaaccttgttcaaatcctatg |
50088303 |
T |
|
| Q |
118 |
ttcttctttccttgtcatttttatagccactgtttatttcatgtcaaaaccacgcacaatctacctcgttgactatgcttgtttcaaaccacctgttaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50088302 |
ttcttctttccttgtcatttttatagccactgtttatttcatgtcaaaaccacgcacaatctacctcgttgactatgcttgtttcaaaccacctgttaca |
50088203 |
T |
|
| Q |
218 |
tgtcgtgtcccctttgctact |
238 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
50088202 |
tgtcgtgtcccttttgctact |
50088182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 23272526 - 23272443
Alignment:
| Q |
155 |
ttcatgtcaaaaccacgcacaatctacctcgttgactatgcttgtttcaaaccacctgttacatgtcgtgtcccctttgctact |
238 |
Q |
| |
|
||||||| ||| ||||||||||||||||| || || ||||| || |||||||| || |||| ||||||||||| || |||||| |
|
|
| T |
23272526 |
ttcatgttaaagccacgcacaatctacctagtcgattatgcctgcttcaaaccgccgattacttgtcgtgtccctttcgctact |
23272443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University