View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19005_high_26 (Length: 240)
Name: NF19005_high_26
Description: NF19005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19005_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 29 - 233
Target Start/End: Original strand, 45089895 - 45090099
Alignment:
| Q |
29 |
atggttttgtaataattttatatgatcaacttgttctaaaatgatgaatattttgtttactagtttatagagatagagaaaggggagtagcgagatataa |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45089895 |
atggttttgtaataattttatatgatcaacttgttataaaatgatgaatattttgtttactagtttatagagatagagaaaggggagtagcgagatataa |
45089994 |
T |
 |
| Q |
129 |
tgaattcagaagaaacatgctaatgatcccaattagtaagtgggaagatttaacagatgatgaagaggttattgaagctctcaaagaggtatatgatgat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45089995 |
tgaattcagaagaaacatgctaatgatcccaattagtaagtgggaagatttaacagatgatgaagaggttaatgaagctctcaaagaggtatatgatgat |
45090094 |
T |
 |
| Q |
229 |
gatgt |
233 |
Q |
| |
|
||||| |
|
|
| T |
45090095 |
gatgt |
45090099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University