View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19005_high_34 (Length: 205)
Name: NF19005_high_34
Description: NF19005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19005_high_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 42471159 - 42471330
Alignment:
| Q |
17 |
gtgctctcttgtggatgtcgtaagtgttgctgcttcattaatttttgtcgtagaaaataaacaaaaataaggaagataaaaattcatatactcatcagtc |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471159 |
gtgctctcttgtggatgttctaagtgttgctgcttcattaatttttgtcgtagaaaataaacaaaaataaggaagataaaaattcatatactcatcagtc |
42471258 |
T |
|
| Q |
117 |
tcctcgattaagcccagctacgacaaggctcttcatgacaaatgataaacaagcccccatcaataatttgtg |
188 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471259 |
tccttgattaagcccagctacgacaaggctcttcatgacaaatgataaacaagcccccatcaataatttgtg |
42471330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University